View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14233_low_11 (Length: 221)
Name: NF14233_low_11
Description: NF14233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14233_low_11 |
 |  |
|
| [»] chr4 (7 HSPs) |
 |  |
|
| [»] chr7 (7 HSPs) |
 |  |
|
| [»] chr1 (4 HSPs) |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |
|
| [»] chr3 (4 HSPs) |
 |  |
|
| [»] scaffold0064 (1 HSPs) |
 |  |
|
| [»] scaffold0173 (1 HSPs) |
 |  |  |
|
| [»] scaffold0084 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 106 - 221
Target Start/End: Complemental strand, 7540372 - 7540257
Alignment:
| Q |
106 |
aggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgttt |
205 |
Q |
| |
|
||||||||||||| |||||| || ||||||||||||| |||||||||||||||||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
7540372 |
aggtttaaatgcacttttggccccctatgtttgccgttgtagcaattttgatcctctaacaaaaaaaatacaattttgaccccctatttttgccatgttt |
7540273 |
T |
 |
| Q |
206 |
agggaaatatgctctt |
221 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7540272 |
agggaaatatgctctt |
7540257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 130 - 221
Target Start/End: Complemental strand, 14612396 - 14612305
Alignment:
| Q |
130 |
ctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||| | |||||||||||||| ||| ||||| |||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
14612396 |
ctatgtttgtcatcgtagcaattttggtcccctaacaaaaaaaatgcaattttgaccccctaattttgccatgtttagggaaatatgctctt |
14612305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 110 - 165
Target Start/End: Original strand, 14612139 - 14612194
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
14612139 |
ttaaatgcacttttggtcctctatgtttgtcgtcgtagcaattttgaccccctaac |
14612194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 110 - 165
Target Start/End: Complemental strand, 47645719 - 47645664
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
47645719 |
ttaaatgcattttttgtcctttatgtttgccttcgtagcaattttgatcccctaac |
47645664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 47645437 - 47645486
Alignment:
| Q |
106 |
aggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
||||||||||| | ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
47645437 |
aggtttaaatgtacttttggtcccctatgtttgccatcgtagcaattttg |
47645486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 221
Target Start/End: Original strand, 32335914 - 32335961
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||| |||||||||| |
|
|
| T |
32335914 |
tgcaattttgaccccttaattttgccatgtttagggatatatgctctt |
32335961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 47645509 - 47645553
Alignment:
| Q |
177 |
aattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||| ||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
47645509 |
aatattgaccccctaattttgccatgtttaggaaaatatgctctt |
47645553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 9e-23; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 106 - 196
Target Start/End: Complemental strand, 18740022 - 18739932
Alignment:
| Q |
106 |
aggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgattttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
18740022 |
aggtttaaatgcatttttggtcctctatgtttgccgttgtagcaattttgaccctctaacaaaaacaatgcaattttgacccccgaatttt |
18739932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 174 - 221
Target Start/End: Complemental strand, 20732745 - 20732698
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
20732745 |
tgcaattttgaccccctaattttgccatgtttagggaaatatgctctt |
20732698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 165
Target Start/End: Complemental strand, 3023801 - 3023746
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||||||||||| || ||||| |
|
|
| T |
3023801 |
ttaaatgcatttttggccctttatgtttgtcgtcgtagcaattttgaccccctaac |
3023746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 18739807 - 18739852
Alignment:
| Q |
176 |
caattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
18739807 |
caattttgaccccttaattttgccatgtttagggaaatatgctctt |
18739852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 221
Target Start/End: Original strand, 16287511 - 16287623
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnn-tgcaattttgacccccgatttttgccatgtttagg |
208 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||| || ||||| |||||||||||||||| | ||||||||||||||| |
|
|
| T |
16287511 |
ttaaatgcatttttgacctcctatgtttgccgtcgtagcaattttagccccctaacaaaaaaaaatgcaattttgaccccctaattttgccatgtttaga |
16287610 |
T |
 |
| Q |
209 |
gaaatatgctctt |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16287611 |
aaaatatgctctt |
16287623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 38322290 - 38322329
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaat |
213 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
38322290 |
tgcaattttgaccccctaattttgccatgtttagggaaat |
38322329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 221
Target Start/End: Complemental strand, 38545491 - 38545444
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||| |||||||||| |
|
|
| T |
38545491 |
tgcaattttgaccccttaattttgccatgtttagggatatatgctctt |
38545444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 26214094 - 26214135
Alignment:
| Q |
175 |
gcaattttgacccccgatttttgccatgtttagggaaatatg |
216 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| ||||||| |
|
|
| T |
26214094 |
gcaattttgaccccctatttttgtcatgtttaggtaaatatg |
26214135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 110 - 221
Target Start/End: Complemental strand, 38723082 - 38722971
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtttaggg |
209 |
Q |
| |
|
||||||||| |||||| || ||||||||||| |||||||| ||||| || ||||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
38723082 |
ttaaatgcacttttggacccctatgtttgccatcgtagcagttttggccccctaacaaaaaaaatgcaattttgaccccctaattttgccatgtttaggg |
38722983 |
T |
 |
| Q |
210 |
aaatatgctctt |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38722982 |
aaatatgctctt |
38722971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 221
Target Start/End: Complemental strand, 9154513 - 9154466
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
9154513 |
tgcaattttggccccctatttttgccatgtttagagaaatatgctctt |
9154466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 165
Target Start/End: Original strand, 38722815 - 38722860
Alignment:
| Q |
120 |
ttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| || ||||| |
|
|
| T |
38722815 |
ttttggtcctctatgttttccgtcgtagcaattttgaccccctaac |
38722860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 221
Target Start/End: Complemental strand, 45782307 - 45782190
Alignment:
| Q |
105 |
taggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgt- |
203 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||| ||||||| || ||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
45782307 |
taggtttaaatgcacttttggtcctctatgtttgctactgtagtaattttgcccccctaacaaaagaaatgcaattttgaccccttaattttgccatgtg |
45782208 |
T |
 |
| Q |
204 |
ttagggaaatatgctctt |
221 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
45782207 |
ttaggaaaatatgctctt |
45782190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 165
Target Start/End: Complemental strand, 35533698 - 35533644
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||||||||||||||| || ||||| |
|
|
| T |
35533698 |
ttaaatgcatttttggccc-ctatgttttccgtcgtagcaattttgaccccctaac |
35533644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 155
Target Start/End: Original strand, 9154300 - 9154345
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
9154300 |
ttaaatgcacttttgaccctctatgtttgccatcgtagcaattttg |
9154345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 155
Target Start/End: Original strand, 45782024 - 45782069
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
45782024 |
ttaaatgcacttttggtcccctatgtttgccaccgtagcaattttg |
45782069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 105 - 165
Target Start/End: Complemental strand, 11919954 - 11919894
Alignment:
| Q |
105 |
taggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||| || ||||| |
|
|
| T |
11919954 |
taggtttaaatgcatttttggtcttctatgtttgccgtcgtagcaattctgaccccctaac |
11919894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 221
Target Start/End: Complemental strand, 22699131 - 22699015
Alignment:
| Q |
105 |
taggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtt |
204 |
Q |
| |
|
|||| ||||||||| ||||| || ||||||||||||||||||||||||||| | ||||| ||||||||| |||||| | ||||| |||||| |
|
|
| T |
22699131 |
taggcttaaatgcacttttgaccccctatgtttgccgtcgtagcaattttgactccctaacaaaaaaaatgcaattttaaccccctaattttgtcatgtt |
22699032 |
T |
 |
| Q |
205 |
tagggaaatatgctctt |
221 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
22699031 |
taggaaaatatgctctt |
22699015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 110 - 165
Target Start/End: Original strand, 25547801 - 25547856
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
25547801 |
ttaaatgcacttttgatcctctatgtttgccgtcgtagcaattttgaccccctaac |
25547856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 9775386 - 9775436
Alignment:
| Q |
105 |
taggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
9775386 |
taggcttaaatgcatttttgatcccctatgtttgccgtcgtagcaattttg |
9775436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 110 - 156
Target Start/End: Complemental strand, 35844992 - 35844946
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttga |
156 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35844992 |
ttaaatgcatttttggccctctatgtttgccttcgtagcaattttga |
35844946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 221
Target Start/End: Original strand, 11919736 - 11919783
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
11919736 |
tgcaattttgaccccctaattttgccatgtttaggaaaatatgctctt |
11919783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 146
Target Start/End: Complemental strand, 35935636 - 35935596
Alignment:
| Q |
106 |
aggtttaaatgcatttttggtcctctatgtttgccgtcgta |
146 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
35935636 |
aggtttaaatgcatttttgatcccctatgtttgccgtcgta |
35935596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 221
Target Start/End: Original strand, 35935371 - 35935482
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtttaggg |
209 |
Q |
| |
|
||||||||| |||||| || |||| ||||||||||||||||||||| || ||||| |||||||| |||||| | ||||| ||||||| || |
|
|
| T |
35935371 |
ttaaatgcacttttggccccctatatttgccgtcgtagcaattttggccccctaacaaaaaaaatgcaatttaaaccccctaattttgtcatgtttcgga |
35935470 |
T |
 |
| Q |
210 |
aaatatgctctt |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35935471 |
aaatatgctctt |
35935482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 155
Target Start/End: Original strand, 22698835 - 22698893
Alignment:
| Q |
97 |
atacttcttaggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
|||||| || || |||||| |||||||| || |||||||||||||||||||||||||| |
|
|
| T |
22698835 |
atacttttttggcttaaatacatttttgaccccctatgtttgccgtcgtagcaattttg |
22698893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 105 - 218
Target Start/End: Complemental strand, 28319289 - 28319176
Alignment:
| Q |
105 |
taggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtt |
204 |
Q |
| |
|
|||| ||||||||| ||||| | |||||||||| ||||||||||||| ||| ||||| |||||||||||||| | | ||||||||||| |
|
|
| T |
28319289 |
taggcttaaatgcacttttgacctcctatgtttgcaaccgtagcaattttggtcccctaacaaaaaaaatgcaattttgaccctctaagtttgccatgtt |
28319190 |
T |
 |
| Q |
205 |
tagggaaatatgct |
218 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28319189 |
tagggaaatatgct |
28319176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 105 - 221
Target Start/End: Complemental strand, 18106992 - 18106876
Alignment:
| Q |
105 |
taggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtt |
204 |
Q |
| |
|
|||||||||||||| ||||| |||| |||| ||| |||| ||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
18106992 |
taggtttaaatgcacttttgacttcctatatttgtcgttgtagtaattttgatcctctaacaaaaaaaaagcaattttgaccccctatttttgccatgtt |
18106893 |
T |
 |
| Q |
205 |
tagggaaatatgctctt |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18106892 |
tagggaaatatgctctt |
18106876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 116 - 160
Target Start/End: Complemental strand, 4850011 - 4849967
Alignment:
| Q |
116 |
gcatttttggtcctctatgtttgccgtcgtagcaattttgatcct |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
4850011 |
gcatttttggtcttctatgtttgccgtcgtaacaattttgatcct |
4849967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 221
Target Start/End: Complemental strand, 23279808 - 23279761
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
23279808 |
tgcaattttgaccccttaattttgccatgtttaggaaaatatgctctt |
23279761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 24749798 - 24749754
Alignment:
| Q |
109 |
tttaaatgcatttttggtcctctatgtttgccgtcgtagcaatttt |
154 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
24749798 |
tttaaatgcacttttggtcc-ctatgtttgccatcgtagcaatttt |
24749754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 130 - 221
Target Start/End: Original strand, 204981 - 205072
Alignment:
| Q |
130 |
ctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||| | |||||||||||||| ||| ||||| |||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
204981 |
ctatgtttgtcatcgtagcaattttggtcccctaacaaaaaaaatgcaattttgaccccctaattttgccatgtttagggaaatatgctctt |
205072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 110 - 165
Target Start/End: Complemental strand, 205238 - 205183
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
205238 |
ttaaatgcacttttggtcctctatgtttgtcgtcgtagcaattttgaccccctaac |
205183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 3e-16; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 110 - 221
Target Start/End: Complemental strand, 24312943 - 24312832
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtttaggg |
209 |
Q |
| |
|
|||||||||||||| | || ||||||||| |||||||||||||||| || ||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
24312943 |
ttaaatgcattttttgccccctatgtttgtcgtcgtagcaattttggccccctaacaaaaacaatgcaattttgaccccttaattttgccatgtttagga |
24312844 |
T |
 |
| Q |
210 |
aaatatgctctt |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
24312843 |
aaatatgctctt |
24312832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 111 - 165
Target Start/End: Original strand, 48743134 - 48743188
Alignment:
| Q |
111 |
taaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
|||||||| |||||| || |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
48743134 |
taaatgcacttttggccccctatgtttgccgtcgtagcaattttggtccactaac |
48743188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 214
Target Start/End: Complemental strand, 48743389 - 48743308
Alignment:
| Q |
133 |
tgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtttagggaaata |
214 |
Q |
| |
|
||||||||| ||||||||||||| || ||||| |||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
48743389 |
tgtttgccgccgtagcaattttggccccctaacaaaaaaaatgcaattttgaccccctaattttgccatgtttagggaaata |
48743308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 207
Target Start/End: Original strand, 1265839 - 1265942
Alignment:
| Q |
104 |
ttaggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgt |
203 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| |||| ||||||||||| | |||||||| || |||||||||||| ||||||| ||||| |
|
|
| T |
1265839 |
ttaggcttaaatgcatttttgcctctctatgtttaccgttgtagcaattttaaccctctaacaaaaaaattgtaattttgaccccttatttttgtcatgt |
1265938 |
T |
 |
| Q |
204 |
ttag |
207 |
Q |
| |
|
|||| |
|
|
| T |
1265939 |
ttag |
1265942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0064 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0064
Description:
Target: scaffold0064; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 131 - 221
Target Start/End: Original strand, 54417 - 54507
Alignment:
| Q |
131 |
tatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnntgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||| ||||||||| |||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
54417 |
tatgtttgtcgtcgtagccattttgatcctctaacaaaaaaaatgcaatttttaccccctaattttgccttgtttagggaaatatgctctt |
54507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 156
Target Start/End: Complemental strand, 32731519 - 32731469
Alignment:
| Q |
106 |
aggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttga |
156 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
32731519 |
aggtttaaatgcatttttggtcctttatgtttgtcgtcgtagaaattttga |
32731469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 132659 - 132611
Alignment:
| Q |
106 |
aggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
132659 |
aggtttaaatgcatttttgaccc-ctatgtttgccgtcgtagcaattttg |
132611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 155
Target Start/End: Complemental strand, 30199665 - 30199620
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
30199665 |
ttaaatgcacttttgatcctttatgtttgccgtcgtagcaattttg |
30199620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 8137609 - 8137650
Alignment:
| Q |
180 |
tttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
8137609 |
tttgaccccatatttttgccacgtttagggaaatatgctctt |
8137650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 32731372 - 32731416
Alignment:
| Q |
177 |
aattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||||||| | |||| ||||||||||| |||||||||||| |
|
|
| T |
32731372 |
aattttgaccccctaatttttccatgtttaggaaaatatgctctt |
32731416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0173 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0173
Description:
Target: scaffold0173; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 216
Target Start/End: Original strand, 22812 - 22918
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaacnnnnnnnn-tgcaattttgacccccgatttttgccatgtttagg |
208 |
Q |
| |
|
||||||||| |||||| || |||||||||| ||||||||||||||| || ||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
22812 |
ttaaatgcacttttggccccttatgtttgccatcgtagcaattttgaccc-ctaacaaaacaaaatgcaattttgaccccctatttttgccatgtttagg |
22910 |
T |
 |
| Q |
209 |
gaaatatg |
216 |
Q |
| |
|
||||||| |
|
|
| T |
22911 |
taaatatg |
22918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0084 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0084
Description:
Target: scaffold0084; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 165
Target Start/End: Original strand, 4513 - 4574
Alignment:
| Q |
104 |
ttaggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
||||| ||||||||| |||||| | ||||||||||||||||||||||||||| || ||||| |
|
|
| T |
4513 |
ttaggcttaaatgcacttttggctcgctatgtttgccgtcgtagcaattttgaccccctaac |
4574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 218
Target Start/End: Original strand, 19176467 - 19176511
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaatatgct |
218 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
19176467 |
tgcaattttgaccccataattttgccatgtttagggaaatatgct |
19176511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 165
Target Start/End: Original strand, 9362745 - 9362800
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttgatcctctaac |
165 |
Q |
| |
|
||||||||| |||||| || |||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
9362745 |
ttaaatgcacttttggcccactatgtttgccgccgtagcaattttggtcccctaac |
9362800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 221
Target Start/End: Original strand, 13118482 - 13118529
Alignment:
| Q |
174 |
tgcaattttgacccccgatttttgccatgtttagggaaatatgctctt |
221 |
Q |
| |
|
||||||||||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
13118482 |
tgcaattttgaccccttattttttcaatgtttagggaaatatgctctt |
13118529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 102 - 155
Target Start/End: Original strand, 655521 - 655574
Alignment:
| Q |
102 |
tcttaggtttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
||||||| ||||||||| |||||| || ||||||||||| | |||||||||||| |
|
|
| T |
655521 |
tcttaggcttaaatgcacttttggccccctatgtttgccatggtagcaattttg |
655574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 155
Target Start/End: Complemental strand, 17144310 - 17144265
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
||||| |||||||||||||||||| ||| || |||||||||||||| |
|
|
| T |
17144310 |
ttaaacgcatttttggtcctctatattttccatcgtagcaattttg |
17144265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 155
Target Start/End: Original strand, 128354 - 128399
Alignment:
| Q |
110 |
ttaaatgcatttttggtcctctatgtttgccgtcgtagcaattttg |
155 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||| |||||||| |
|
|
| T |
128354 |
ttaaatgcacttttggccccctatgtttgccgtcgtatcaattttg |
128399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University