View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14233_low_12 (Length: 201)
Name: NF14233_low_12
Description: NF14233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14233_low_12 |
 | |
|
| [»] scaffold0432 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 9816118 - 9815942
Alignment:
| Q |
1 |
tggatagttgttatgtaatatgatggttactacttgagttctttcttcatactcaactgaatatctattttctgactgggtcatcacaataaaattgttg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9816118 |
tggatagttgttatgtaatatggtggttactacttgagttttttcttcatactcaactgaatatctattttctgactgggtcatcacaataaaattgttg |
9816019 |
T |
|
| Q |
101 |
caagaagttattgaagaaatttttaaattctattttcatatatcgatgtagtactcttttttaattgcttagtacgc |
177 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9816018 |
caagaagttattgaagaaatttctaaattctattttcatatatcgatgcagtactcttttttaattgcttagtacgc |
9815942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 9902 - 9726
Alignment:
| Q |
1 |
tggatagttgttatgtaatatgatggttactacttgagttctttcttcatactcaactgaatatctat--tttctgactgggtcatcacaataaaattgt |
98 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
9902 |
tggatagttgttatgtaatatg-tggttactacttgagttttttcttcatactcaactgaatatctatattttctgactgg-tcatcacaatagaattgt |
9805 |
T |
|
| Q |
99 |
tgcaagaagttattgaagaaatttttaaattctattttcatatatcgatgtagtactcttttttaattgcttagtacgc |
177 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| |||||||||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
9804 |
tgcaagaagttattgaattaatttctaaattctattgtcatatatcgatttagtactcttttttaactgctttgtacgc |
9726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University