View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14233_low_2 (Length: 404)
Name: NF14233_low_2
Description: NF14233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14233_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 8e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 19 - 168
Target Start/End: Complemental strand, 2485803 - 2485654
Alignment:
| Q |
19 |
taaggtaatgtgtgttttgatttctggaaatggtgatcttatgagagttcccgctatttctggtgcggtctttattttcttctcttattcaagtttaaag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2485803 |
taaggtaatgtgtgttttgatttctggaaatggtgatcttatgagagttcccgctatttctggtgcggtctttattttcttctcttattcaagtttaaat |
2485704 |
T |
 |
| Q |
119 |
gatggagactagtgctgactcatgcatgcattcttacgtgtctctctctt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2485703 |
gatggagactagtgctgactcatgcatgcattcttacgtgtctctctctt |
2485654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University