View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14234_high_13 (Length: 445)

Name: NF14234_high_13
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14234_high_13
NF14234_high_13
[»] chr7 (1 HSPs)
chr7 (15-171)||(44555029-44555185)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 3e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 15 - 171
Target Start/End: Complemental strand, 44555185 - 44555029
Alignment:
15 aaggcaaatggtggaatggaatgcggaatataaactagggtttgggagtttactttgggcttacgggttatttcacttgtctttagcccatttagtgcat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
44555185 aaggcaaatggtggaatggaatgcggaatataaactagggtttgggagtttactttgggcttacgggttatttcacttgtcttaagcccatttagtgcat 44555086  T
115 ctcctcggcccaacaatctttataaactttannnnnnnnattcaatctttataaacc 171  Q
    ||||||||||||||||||||||| |||||||        ||||||||||||||||||    
44555085 ctcctcggcccaacaatctttattaactttattttttttattcaatctttataaacc 44555029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University