View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_high_51 (Length: 258)
Name: NF14234_high_51
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 32902942 - 32902713
Alignment:
| Q |
18 |
acctagatgttgagcaacttgaagcgaagacgacgttcttttatgatagtttggaggaagagatctatagtcttgaagataatcatattatcaactctcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32902942 |
acctagatgttgagcaacttgaagcgaagacgacgttcttttatgatagtttgggggaagagatctatagtcttgaagataatcatattatcaactctcc |
32902843 |
T |
 |
| Q |
118 |
taagacttctacaaattgaatgaaaaatttcttgagtcacgacgatattgtcatgatattgaaattaattttaaccttatgcaaaacttatattttgtct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32902842 |
taagacttctacaaattgaatgaaaaatttcttgagtcacgacgatattgtcatgatattgaaattaattttaaccttatgcaaaacttatattttgtct |
32902743 |
T |
 |
| Q |
218 |
aaattcactttcacacatacagttgttcat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32902742 |
aaattcactttcacacatacagttgttcat |
32902713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University