View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_16 (Length: 445)
Name: NF14234_low_16
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 3e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 15 - 171
Target Start/End: Complemental strand, 44555185 - 44555029
Alignment:
| Q |
15 |
aaggcaaatggtggaatggaatgcggaatataaactagggtttgggagtttactttgggcttacgggttatttcacttgtctttagcccatttagtgcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44555185 |
aaggcaaatggtggaatggaatgcggaatataaactagggtttgggagtttactttgggcttacgggttatttcacttgtcttaagcccatttagtgcat |
44555086 |
T |
|
| Q |
115 |
ctcctcggcccaacaatctttataaactttannnnnnnnattcaatctttataaacc |
171 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
44555085 |
ctcctcggcccaacaatctttattaactttattttttttattcaatctttataaacc |
44555029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University