View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_26 (Length: 370)
Name: NF14234_low_26
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 10 - 355
Target Start/End: Original strand, 5597279 - 5597621
Alignment:
| Q |
10 |
aagaaaatcaaaatataaacaattattcgatatcaatcaaacaatcatcaatatgctaattgtgtgcatgcgacctatttgtgatggcgaaaaatccgaa |
109 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
5597279 |
aagaaaatcaaaatgtaaacaatt---cgatatcaatcaaacaatcatcaatatgctaattgtgtgaatgcgaccaatttgtgatggcgaaaaatccgaa |
5597375 |
T |
 |
| Q |
110 |
ttctcaagggccacatccgtacagtttataggttggtgtacatgataatcatctatgatctatcatctcatcaatgctttatgattttaatgagccatgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5597376 |
ttctcaagggccacatccgtacagtttataggttggtgtacatgataatcatctatgatctatcatctcatcaatgctttatgattttaatgagccatgc |
5597475 |
T |
 |
| Q |
210 |
gtttggattgtgacttatttctgtttattatcttcactcaattcattttgtattttgacttttgcttgaaggtgataacttgtcttcaagtgaaataaaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5597476 |
gtttggattgtgacttatttctgtttattatcttcactcaattcattttgtattttgacttttgcttgaaggtgataacttgtcttcaagtggaataaaa |
5597575 |
T |
 |
| Q |
310 |
gataggttagatggtgacttgaagaaaagtgtgaatccattggaag |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5597576 |
aataggttagatggtgacttgaagaaaagtgtgaatccattggaag |
5597621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University