View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_29 (Length: 350)
Name: NF14234_low_29
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 233 - 331
Target Start/End: Original strand, 21728950 - 21729047
Alignment:
| Q |
233 |
agatattgatggtttacagtaagagtttttgtttaagttgaattgaaatgtgaatttttgaaagnnnnnnnnggtgggatttttattttatgttataaa |
331 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21728950 |
agatattgatggtttacggtaagagtttttgtttaagttgaattgaaatgtaaatttttgaaag-aaaaaaaggtgggatttttattttatgttataaa |
21729047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 44 - 81
Target Start/End: Original strand, 21728766 - 21728803
Alignment:
| Q |
44 |
gtgtgcaattgaaaacgaagaaaagggaaaaagatgaa |
81 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21728766 |
gtgtgaaattgaaaacgaagaaaagggaaaaagatgaa |
21728803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University