View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_38 (Length: 310)
Name: NF14234_low_38
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 13 - 294
Target Start/End: Complemental strand, 7022895 - 7022613
Alignment:
| Q |
13 |
atattatactcctaatagacccatgattctatagccgactttccctaaaccgataaagtttatggatcttgtaaatttcactcgttctttcctcttcaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7022895 |
atattatactcctaatagacccatgattctatagccgactttccctaaaccgataaagtttatggatcttgtaaatttcactcgttctttcctcttcaca |
7022796 |
T |
|
| Q |
113 |
tgcatgtcttcttttggactatcatgaattaacaaaacaaaaaataaacttacgaatataattgagctgacatgaccaaatcacttgaat-aaataattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7022795 |
tgcatgtcttcttttggactatcatgaattaacaaaacaaaaaataaacttacgaatataattgagctgacatgaccaaatcacttgaataaaataattt |
7022696 |
T |
|
| Q |
212 |
gttgacaattggtattattttacaagttaacttttcaatataaaagttatgttttcatagtagtatttactgcaggttgcaaa |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7022695 |
gttgacaattggtattattttacaagttaacttttcaatataaaagttatgttttcatagtagtatttacagcaggttgcaaa |
7022613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University