View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_40 (Length: 303)
Name: NF14234_low_40
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 42368408 - 42368167
Alignment:
| Q |
1 |
aaagtcgatgtccgttatacaattcttttatttttaaggattgtcagttaagaaaatgtaagtttcagttttgctgatagtccttgtcaagatgtaattc |
100 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42368408 |
aaagttgatgtccgttatacgattcttttatttttaaggattgtcagttaagaaaatgtaagtttcagttttgctgatagtccttgtcaagatgtaattc |
42368309 |
T |
|
| Q |
101 |
ctgattgtgtatagtatatagaagatttcattcattttaatttatagataca------------tgaaatgcataatgactatgctgttgtttgcacttg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||| |
|
|
| T |
42368308 |
ctgattgtgtatagtatatagaagatttcattcattttaatttatagatacatgaatgtatacatgaaatgcataatgactatgcagctgtttgcacttg |
42368209 |
T |
|
| Q |
189 |
tctatgcttgcataaatgcaaaatgaaatttttggtctttga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42368208 |
tctatgcttgcataaatgcaaaatgaaatttttggtctttga |
42368167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University