View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_41 (Length: 299)
Name: NF14234_low_41
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 14 - 286
Target Start/End: Original strand, 38479384 - 38479656
Alignment:
| Q |
14 |
tgagatttaggaaatgataaatattttaatgtgtccttgggtggcatgttatgcattatgctagaggatagtggtaatgtaaaagtcgttctccagttat |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38479384 |
tgagttttaggaaatgataaatattttaatgtgtccttgggtggcatgttatgcattatgctagaggatagtggtaatgtaaaagtcgttttccagttat |
38479483 |
T |
|
| Q |
114 |
aaagcatctaatctcttttacaagctgcaattggtgttatcttttggtagtttcttttcacattttctcttgtttctgtttcatacagattataagttca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38479484 |
aaagcatctaatctcttttacaagctgcaattggtgttatcttttggtagtttcttttcacattttctcttgtttctgtttcatacagattataagttca |
38479583 |
T |
|
| Q |
214 |
ttcatgctggaatctaacttgttaatttcactcataggctctctcgtaaggccaaaggttgttaaaagtgttc |
286 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38479584 |
tccatgctggaatctaacttgttaatttcactcataggctctctcgtaaggccaaaggttgttaaaagtgttc |
38479656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University