View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_46 (Length: 279)
Name: NF14234_low_46
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 60 - 264
Target Start/End: Original strand, 10421768 - 10421972
Alignment:
| Q |
60 |
ggtagacttgaaggtagaaacgatgtgagtaggaaacaaccggtgatattacaacatggagtattggtggtaagttggtaattaaaatgcatgcaatgca |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10421768 |
ggtagacttgaaggtagaaacgatgtgagtaggaaacaaccggtgatattacaacatggagtattggtggtaagttggtaattaaaatgcatgcaatgca |
10421867 |
T |
 |
| Q |
160 |
cacattcctgattctgttacttttattttttcatgtggtggcttttagcattagaagatgaaaaatatttcctaannnnnnngtggataagattatttct |
259 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
10421868 |
cacattcctgtttctgttacttttattttttcatgtggtggcttttagcattagaagatgaaaaatatttccaaatttttttgtggatgagattatttct |
10421967 |
T |
 |
| Q |
260 |
ttaca |
264 |
Q |
| |
|
||||| |
|
|
| T |
10421968 |
ttaca |
10421972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 10421612 - 10421666
Alignment:
| Q |
1 |
gaatatagttttctctctattcaacgactaagatttagctagatatgccggacaa |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10421612 |
gaatatagttttctctctattcaacgactaagatttagctgaatatgccggacaa |
10421666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University