View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_47 (Length: 278)
Name: NF14234_low_47
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 264
Target Start/End: Original strand, 46910439 - 46910694
Alignment:
| Q |
9 |
gaaatgaaccacgtaatgaaagcgccttgcttaacacaggatcactgcagacaacaaaaggtggacattctttaccgtttcttgaactccaacaagctag |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46910439 |
gaaaagaaccacgtaatgaaagcgccttgcttaacacaggatcactgcagacaacaaaaggtggacattctttaccgtttcttgaactccaacaagctag |
46910538 |
T |
|
| Q |
109 |
cttttccaagaaaacaagagttgatagaactgatactcctcctataacaccaacagtattttgttggcttagtttgatgcatgatgcggaagatatgtga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46910539 |
cttttccaagaaaacaagagttgatagaactgatactcctcctataacaccaatagtattttgttggcttagtttgatgcatgatgcggaagatatgtga |
46910638 |
T |
|
| Q |
209 |
cctctcatcagggaagtaccattgcctggttcctcgtagtttccactctcatcagt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46910639 |
cctctcatcagggaagtaccattgcctggttcctcgtagtttccactctcatcagt |
46910694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University