View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_65 (Length: 242)
Name: NF14234_low_65
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 13 - 117
Target Start/End: Complemental strand, 48663389 - 48663285
Alignment:
| Q |
13 |
agcagcacagagtaattgctttataagagacaaatagatagattgatgcttaatttaggaattctttatagtataagattgtatagcttataaacataaa |
112 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48663389 |
agcatcacaaagtaattgctttataagagacaaatagatagattgatgcttaatttaggaattctttatagtataagattgtatagcttataaacataaa |
48663290 |
T |
 |
| Q |
113 |
cgtac |
117 |
Q |
| |
|
|||| |
|
|
| T |
48663289 |
ggtac |
48663285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 110 - 218
Target Start/End: Complemental strand, 48662549 - 48662441
Alignment:
| Q |
110 |
aaacgtacgtatgcagaaaccaaattaggtgggggattttaatctttagttcattatatgtttatactttatattacacctcattttcccacagcccagt |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| | ||||||| ||| |||||||||| |||||||||||| ||||| | |||||| |||| |
|
|
| T |
48662549 |
aaacgtacatatgcagaaaccaaattaggtgggggatttaatactttagtacatactatgtttatattttatattacacttcattgactcacagctcagt |
48662450 |
T |
 |
| Q |
210 |
catttactc |
218 |
Q |
| |
|
||||||||| |
|
|
| T |
48662449 |
catttactc |
48662441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University