View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14234_low_65 (Length: 242)

Name: NF14234_low_65
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14234_low_65
NF14234_low_65
[»] chr1 (2 HSPs)
chr1 (13-117)||(48663285-48663389)
chr1 (110-218)||(48662441-48662549)


Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 13 - 117
Target Start/End: Complemental strand, 48663389 - 48663285
Alignment:
13 agcagcacagagtaattgctttataagagacaaatagatagattgatgcttaatttaggaattctttatagtataagattgtatagcttataaacataaa 112  Q
    |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48663389 agcatcacaaagtaattgctttataagagacaaatagatagattgatgcttaatttaggaattctttatagtataagattgtatagcttataaacataaa 48663290  T
113 cgtac 117  Q
     ||||    
48663289 ggtac 48663285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 110 - 218
Target Start/End: Complemental strand, 48662549 - 48662441
Alignment:
110 aaacgtacgtatgcagaaaccaaattaggtgggggattttaatctttagttcattatatgtttatactttatattacacctcattttcccacagcccagt 209  Q
    |||||||| |||||||||||||||||||||||||||||| |  ||||||| |||  |||||||||| |||||||||||| |||||  | |||||| ||||    
48662549 aaacgtacatatgcagaaaccaaattaggtgggggatttaatactttagtacatactatgtttatattttatattacacttcattgactcacagctcagt 48662450  T
210 catttactc 218  Q
    |||||||||    
48662449 catttactc 48662441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University