View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_68 (Length: 223)
Name: NF14234_low_68
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_68 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 11859456 - 11859646
Alignment:
| Q |
15 |
aattgctactagacttgttttgaaattggaggagcttaatcaggaggaatcttggtcattgtttcagcagattcatggaccaattacttcagccaaaaaa |
114 |
Q |
| |
|
||||||| |||||| ||||||||| ||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11859456 |
aattgctgctagacatgttttgaagttgcaggggcttaatcaagaggaatcttggtcattgtttcagcagattcatggaccaattacttcaaccaaaaaa |
11859555 |
T |
|
| Q |
115 |
gaacaaagcaccattgaacc------tgaacatgaacgggagatcgtggagggttgtggtggagttcctcttttgattgtgatcgtagcga |
199 |
Q |
| |
|
| |||||||||| |||||| ||||| |||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11859556 |
gtgcaaagcaccactgaacccgaacgtgaacctgaacgggagattgtggaaggttgtgctggagttcctcttttgattgtgatcgtagcga |
11859646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 30 - 134
Target Start/End: Original strand, 11827330 - 11827434
Alignment:
| Q |
30 |
tgttttgaaattggaggagcttaatcaggaggaatcttggtcattgtttcagcagattcatggaccaattacttcagccaaaaaagaacaaagcaccatt |
129 |
Q |
| |
|
||||||||| ||| ||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
11827330 |
tgttttgaagttgcaggggcttaatcaaaaggaatcttggtcattgtttcagcagatttatggaccaattacttcaaccaaaaaagcacaaagcaccatc |
11827429 |
T |
|
| Q |
130 |
gaacc |
134 |
Q |
| |
|
||||| |
|
|
| T |
11827430 |
gaacc |
11827434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University