View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_70 (Length: 220)
Name: NF14234_low_70
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 158
Target Start/End: Original strand, 35690014 - 35690164
Alignment:
| Q |
12 |
cgaagaatattatataaaaggacaaaatgaatttttctttgtgaacaaatgaaatttaatttggttacgtattttgaatattttagttttat----atga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35690014 |
cgaagaatattatataaaaggacaaaatgaatttttctttgtgaacaaatgaaatttaatttggttacgtattttgaatattttagttttatatgaatga |
35690113 |
T |
 |
| Q |
108 |
tataggagaagacgtatgtacggtactagatacatttgaccctgttctcca |
158 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35690114 |
tataggagaagacgtatgtacggtaccagatacatttgaccctgttctcca |
35690164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University