View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14234_low_72 (Length: 215)
Name: NF14234_low_72
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14234_low_72 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 4523782 - 4523568
Alignment:
| Q |
1 |
tgtggcatttgctttgcaacaattttcgtacaatgtctttccctttttgacgttgtcaaagctagaatgactatgctgatttgatgtttgttgatgttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
4523782 |
tgtggcatttgctttgcaacaattttcgtacaatgtctttccctttttgacgttgtcaaaggtagaatgactatgttgatttaatgtttgttgatgttat |
4523683 |
T |
 |
| Q |
101 |
gttagtttatggtttaagttatatctacnnnnnnngttgatttgcttatgacagtgtgatttatatgtacttgatttcttatgacaatgtggtttatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4523682 |
gttagtttatggtttaagttatatctactttttttgttgatttgcttatgacagtgtgatttatatgtacttgatttcttatgacaatgtggtttatatg |
4523583 |
T |
 |
| Q |
201 |
tagtgtccttgtttt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4523582 |
tagtgtccttgtttt |
4523568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University