View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14235_low_14 (Length: 227)
Name: NF14235_low_14
Description: NF14235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14235_low_14 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43963027 - 43963253
Alignment:
| Q |
1 |
ctaacaactctaacatcttannnnnnngtgaccgacggtaattaacttttccaaaatttcagcatcacgacttgcgtctatgttgtatggcagctgttcc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43963027 |
ctaacaactctaacatcttatttttttgtgaccgacggtaattaacttttccaaaatttcagcatcacgacttgcgtctatgttgtatggcagctgttcc |
43963126 |
T |
 |
| Q |
101 |
agatatcttgttacgatcctgcttactttattttagtgaaacatagtcacaggcaagtatctatgtcatttgtttgtttcaatttttggacattgtattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43963127 |
agatatcttgttacgatcctgcttactttattttagtgaaacatagtcacaggcaagtatctgtgtcatttgtttgtttcaatttttggacattgtattt |
43963226 |
T |
 |
| Q |
201 |
atgactgaaatatgcatgacacaacat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43963227 |
atgactgaaatatgcatgacacaacat |
43963253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 45 - 160
Target Start/End: Original strand, 43958094 - 43958209
Alignment:
| Q |
45 |
acttttccaaaatttcagcatcacgacttgcgtctatgttgtatggcagctgttccagatatcttgttacgatcctgcttactttattttagtgaaacat |
144 |
Q |
| |
|
||||||||||| |||||| || || | |||| | || || |||| ||||||||||||||||||| || | ||||||||||| ||||||||||| ||| |
|
|
| T |
43958094 |
acttttccaaactttcagtattaccagttgcatgtacgtagtattgcagctgttccagatatctagtcaagatcctgcttatcttattttagtgcgtcat |
43958193 |
T |
 |
| Q |
145 |
agtcacaggcaagtat |
160 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
43958194 |
agtgacaggcaagtat |
43958209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University