View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_high_64 (Length: 227)
Name: NF14236_high_64
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_high_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 36444996 - 36445201
Alignment:
| Q |
16 |
ctcaacgactggaacaaaggcccacacttcaccagttacgtcgatttcgcccaactagcccagcccagcatatcaagcccatgggcttcatggtccaact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36444996 |
ctcaacgactggaacaaaggcccacacttcaccagttacgtcgatttcgcccaactagcccagcccagcatatcaagcccatgggcttcatggtccaact |
36445095 |
T |
|
| Q |
116 |
tccctcctccatctctctccgattgccgcaacaatctcaaccaatgcctcgaatccatggcggagaaagcactccgattaggatcccttacttctcgtca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36445096 |
tccctcctccatctctctccgattgccgcaacaatctcaaccaatgcctcgaatccatggcggagaaagcactccaattaggatcccttacttctcgtca |
36445195 |
T |
|
| Q |
216 |
gatctt |
221 |
Q |
| |
|
|||||| |
|
|
| T |
36445196 |
gatctt |
36445201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University