View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_high_66 (Length: 218)
Name: NF14236_high_66
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_high_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 53480647 - 53480449
Alignment:
| Q |
17 |
atacattctaaaagatatcttcctattgaaattggcat-------------gcgcaacccccctacaccaataccatcgttatttgcagtattcacaatc |
103 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53480647 |
atacattctaagagatatcttcctattgaaattggcatctcctccatctccgctcaacccccctacaccaataccatcgttatttgcagtattcacaatc |
53480548 |
T |
 |
| Q |
104 |
acatttttatccaaagataacttaacatgacctattaaatctctcacgcaatgccatcccactcactcgatgatctttccaaaacacagtgtcactacc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
53480547 |
acatttttatccaaagataacttaacatgacctattaaatctctcacgcaatgccatcccactcactcaaggatctttccaaaacatagtgtcactacc |
53480449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University