View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_high_68 (Length: 210)
Name: NF14236_high_68
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_high_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 45863856 - 45863678
Alignment:
| Q |
13 |
ggagcacagacgtagacaacagacatgacactgatacacatatgtaataatttgagaaaatgaattgaatgtgattatgtgacacgttcacacttctctn |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45863856 |
ggagcacggacgtagacaacagacatgacactgatacacatatgtaataatttgagaaaatgaattgaatgtgattatgtgacacgttcacacttctcta |
45863757 |
T |
|
| Q |
113 |
nnnnnntgaagtaattgaatgtaatcacattagtgtgcctgtgtctgtatctgagctattggataccagacatgccttt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
45863756 |
agaaaatgaagtaattgaatgtaatcacattagtgtgtctgtgtctgtgtctgagctgttggataccagacatgccttt |
45863678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University