View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_high_69 (Length: 205)
Name: NF14236_high_69
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_high_69 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 39488513 - 39488312
Alignment:
| Q |
1 |
ttattcattcatcattttcattcacctaaaatatatacattaaagacatcaatgatatccaagtgaaatctcacatcagatgtggatgaaacattttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
39488513 |
ttattcattcatcattttcattcacctaaaatatatacattaaagacatcaatgacatccaagtgaaatctcatatgagatgtggatgaaacattttctt |
39488414 |
T |
 |
| Q |
101 |
acttaaaattataaggatccaacgttcaaaagttcaaactgacagtctgattaggatcacctatattttgaacagttttcttgcatgcatgcaggtcaga |
200 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39488413 |
acttaaaatt---aggattcaacgttcaaaagttcaaacagacagtctgattaggatcacctatattttgaacagttttcttgcatgcatgcaggtcaga |
39488317 |
T |
 |
| Q |
201 |
gacac |
205 |
Q |
| |
|
||||| |
|
|
| T |
39488316 |
gacac |
39488312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University