View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_low_33 (Length: 374)
Name: NF14236_low_33
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 6e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 31 - 259
Target Start/End: Original strand, 35455449 - 35455675
Alignment:
| Q |
31 |
aaattgaactgtgataat-tcataagctgctttgaaaagtaggaaaatatagactgatgaatttatttgtgggcctgtgttaagcagagtttgttataag |
129 |
Q |
| |
|
|||||||||| ||||| | ||||||| |||||||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| || |
|
|
| T |
35455449 |
aaattgaactctgatactctcataagatgctttgaaa-gtaggaaaatatagactgatgaatttatttatgggccattgttaagcagagtttgttatgag |
35455547 |
T |
 |
| Q |
130 |
ctttatgtcttgatcaatcgggtatatgcatatcaaatttaattcatgcactatgcacgaaatgttattaatgctagggcaaggttcatgagtgtaattg |
229 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35455548 |
ttttatgtcttgatcaatcgggcatatgcatatcaaatttaattcatacactatgcacgaaatgttattaatgctagggcaaggttcat--gtgtaattg |
35455645 |
T |
 |
| Q |
230 |
aaaaatgccagatattaggggtccagcagg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35455646 |
aaaaatgccagatattaggggtccagcagg |
35455675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University