View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_low_35 (Length: 368)
Name: NF14236_low_35
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 234947 - 235144
Alignment:
| Q |
19 |
tagaccatctcttgtcgtatggaatacccattgtcatcattaactactaagccatcccatgagcattatctaaatcgtgacgcttctactaccccataat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
234947 |
tagaccatctcttgtcgtatggaatacccattgtcatcattaactactaagccatctcatgagcattatctaaatcgtgacgcttctactaccccataat |
235046 |
T |
 |
| Q |
119 |
ctgcatatacaaataattgtactttctagggaacacactattttaacgagatgggttcttcggtgtcgcagaaaatgcattaaatgatgttgtgaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
235047 |
ctgcatatacaaataattgtactttctagggaacacactattttaacgagatgggttcttgggtgtagcagaaaatgcattaaatgatgttgtgaaca |
235144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 208 - 353
Target Start/End: Original strand, 235527 - 235683
Alignment:
| Q |
208 |
ttgtgaacaaaccattaaattcattcttcagtttgaaaggcattggaaaacaaccaat--------------atctctcaaaattcgcctattgcatgac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
235527 |
ttgtgaacaaaccattaaattcattcttcagtttgaaaggcattggaaaacaaccaatgacaaacaaccaatatctctcaaaattcgcatattgcatgac |
235626 |
T |
 |
| Q |
294 |
atgttgtagtgcccaccaataaggacttggcaatggcaaaacgcaggctttattctatat |
353 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
235627 |
atgt---agtgcccaccaataaggacttggcaatggcaaaacgcaggctttattctatat |
235683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University