View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_low_40 (Length: 333)
Name: NF14236_low_40
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 327
Target Start/End: Complemental strand, 1947935 - 1947637
Alignment:
| Q |
16 |
catgatgatgatgatataaacttgaaatatggtgtgcacatattttcttcaattccacatgattagaaatgtattttggtgcnnnnnnnnn-cctttcta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1947935 |
catgatgatgatgatataaacttgaaatatggtgtgcacatattttcttcaattccacatgattagaaatgtattttggtgcttttttttttcctttcta |
1947836 |
T |
|
| Q |
115 |
atattgaactattcttaatgtcacatttataccttaatcgcaaacacttgggggcatgcttggttttgaaaccacaagaatttattttgtaaaattaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1947835 |
atattgaactattcttaatgtcacatttataccttaatcgcaaacacttgggggcatgcttggttttgaaaccaa--------------taaaattaatt |
1947750 |
T |
|
| Q |
215 |
ttacttaaaatgagttgaacgtaaagtttttatttttcaagtgaagttcatcgatgttggtattttctcataatcatatcatatatcacattattttaaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1947749 |
ttacttaaaatgagttgaacgtaaagtttttatttttcaagtgaagttcatcgatgttggtattttctcataatcatatcatatatcacattattttaaa |
1947650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 2030090 - 2030154
Alignment:
| Q |
20 |
atgatgatgatataaacttgaaatatggtgtgcacatatt---ttcttcaattccacatgattag |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||| |
|
|
| T |
2030090 |
atgatgatgatataaacttgaaatatggtgtgcacatatttagttctttagttccacatgattag |
2030154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 232
Target Start/End: Original strand, 4273259 - 4273298
Alignment:
| Q |
193 |
aatttattttgtaaaattaattttacttaaaatgagttga |
232 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4273259 |
aattgattttgtaaaattaattttacttaaaatgagttga |
4273298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 2031053 - 2031117
Alignment:
| Q |
20 |
atgatgatgatataaacttgaaatatggtgtgcacatatt---ttcttcaattccacatgattag |
81 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
2031053 |
atgatgatgatataaacttgaaaatttgcgtgcacatatttaattcttcaattccacatgattag |
2031117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 261 - 317
Target Start/End: Original strand, 30537801 - 30537857
Alignment:
| Q |
261 |
ttcatcgatgttggtattttctcataatcatatcatatatcacattattttaaacat |
317 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||||||||||| || |||| |||||| |
|
|
| T |
30537801 |
ttcatcgatgttgatattttctcatcatcaaatcatatatcatatcatttaaaacat |
30537857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University