View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_low_50 (Length: 282)
Name: NF14236_low_50
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 85 - 233
Target Start/End: Original strand, 40115888 - 40116038
Alignment:
| Q |
85 |
ccaactattttaacaaatgacatttaannnnnnn--cattatttatgaaacagacttatttttgaattcatgatcgataagtcataagcggtgtcctacc |
182 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115888 |
ccaactattttaacaaatgacatttaatttttttttcattatttatgaaacagacttatttttgaattcatgatcgataagtcataagcggtgtcctacc |
40115987 |
T |
 |
| Q |
183 |
aagtactacagcagcatatgaagctgctaactgagatactgccataatggg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115988 |
aagtactacagcagcatatgaagctgctaactgagatactgccataatggg |
40116038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University