View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_low_51 (Length: 281)
Name: NF14236_low_51
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_low_51 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 4 - 281
Target Start/End: Complemental strand, 7988705 - 7988432
Alignment:
| Q |
4 |
tcacaaataacttgacacgtgtctgaagaaacattccacactttgttatttttgtttttccatatgctccacattaaagtgctnnnnnnnnnnnnnttga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7988705 |
tcacaaataacttgacacgtgtctgaagaaacattccacactttgttatttttgtttttccatatgctccacattaaagtgctaaaaaagtaaaaattga |
7988606 |
T |
 |
| Q |
104 |
atgttgggtaggttgcagatgcagcagaatttcgaaaatgatagtggatatgttgccgacatttgaaacaacatatgaaacttcgtaccatagccccatc |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
7988605 |
atgttgg-taggttgcagatgcagcagaatttcgaaaatgatactggatatgttgccgacatttgaaaca---tgtgaaactttgtaccatagccccatc |
7988510 |
T |
 |
| Q |
204 |
tgctgccaacattgcgcgcttttgggacaggtgaatagcgcgtgcgtactgtcctcattttcgtcacaaaacgtacac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7988509 |
tgctgccaacattgcgcgcttttgggacaggtgaatagcgcgtgcgtactgtcctcattttcgctacaaaacgtacac |
7988432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University