View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_low_63 (Length: 240)
Name: NF14236_low_63
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 22 - 224
Target Start/End: Original strand, 38791982 - 38792184
Alignment:
| Q |
22 |
attgattagttaaataattaatctaacatctttaagcttgtagcaattttatgcacgtgtttatcatttacttcatctttatttacagttctttagagaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791982 |
attgattagttaaataattaatctaacatctttaagcttgtagcaattttatgcacgtgtttatcatttacttcatctttatttacagttctttagagaa |
38792081 |
T |
|
| Q |
122 |
acacatgataacttagattgaattcgtcacactggtttaattgtcnnnnnnnnnnnnctatgatggttgtctttgatgatacatcaatttaatgcatgca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38792082 |
acacatgataacttagattgaattcgtcacactggtttaattgtcttttttgtctttctatgatggctgtctttgatgatacatcaatttaatgcatgca |
38792181 |
T |
|
| Q |
222 |
ttt |
224 |
Q |
| |
|
||| |
|
|
| T |
38792182 |
ttt |
38792184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University