View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14236_low_67 (Length: 229)

Name: NF14236_low_67
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14236_low_67
NF14236_low_67
[»] chr3 (1 HSPs)
chr3 (128-210)||(39613493-39613575)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 39613575 - 39613493
Alignment:
128 ctagtaactggttcttcgacgaagaagacatggatttcgtttcagacttcaaagatctccccataaaattccaacaaacatta 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39613575 ctagtaactggttcttcgacgaagaagacatggatttcgtttcagacttcaaagatctccccataaaattccaacaaacatta 39613493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University