View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14236_low_72 (Length: 215)
Name: NF14236_low_72
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14236_low_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 15 - 200
Target Start/End: Complemental strand, 35574173 - 35573988
Alignment:
| Q |
15 |
agcagagacagcaacagcatccgcaccggcgacttttgcggcgagtgtagttggcgtaacgttgtgcattttctggtggagggatgcggtaggtttgatc |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35574173 |
agcaaagacagcaacagcatccgcaccggcgacttttgcggcgagtgtagttggcgtaacgttgtgcattctctggtggagggatgcggtaggtttgatc |
35574074 |
T |
 |
| Q |
115 |
cttggggagctggatgacataggttccggacggcggcggtgacgatgatggagcggtgttggacttggaaggtggagaggatttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35574073 |
cttggggagctggatgacataggttccggacggcggcggtgacgatgatggaacggtgttggacttggaaggtggagaggatttag |
35573988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University