View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14238_low_11 (Length: 307)
Name: NF14238_low_11
Description: NF14238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14238_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 12 - 290
Target Start/End: Complemental strand, 43815100 - 43814823
Alignment:
| Q |
12 |
acagaacaagacatattaagagctggctctttaaacagatttggaagaaaattcatcgatgcaagcaatggccatgaagtatgtacttgtagaaactcgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43815100 |
acagaacaagacatattaagagctggctctttaaacagatttgaaagaaaattcaccgatgcaagcaatggccatgaagtatgtacttgtagaaactcga |
43815001 |
T |
 |
| Q |
112 |
ttttttcgtttatcaagaattcagtttggctcaatatcaggggttcatattagacaaacttatttctttaaagtgataattttgtgagatcattatcctt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43815000 |
ttttttcgtttatcaagaattcagtttggctcaatattaggg-ttcatattagacaaacttatttctttaaagtgataattttgtgagatcattatcctt |
43814902 |
T |
 |
| Q |
212 |
ttttcatttaaagtgatcaatgagtttcatggcccctatttaaattattgtttcatcatgcacatataagcaagagtct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43814901 |
ttttcatttaaagtgatcaatgagtttcatggcccctatttaaattattgtttcatcatgcacatataagcaagagtct |
43814823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University