View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14238_low_12 (Length: 290)
Name: NF14238_low_12
Description: NF14238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14238_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 13 - 273
Target Start/End: Complemental strand, 48487053 - 48486791
Alignment:
| Q |
13 |
agcatagggtaagctcttctcaacacacctttatgtaaaggtttgagttgttgttattgttgaaatctaatgaatttgtgatgggcacttggcaggacta |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48487053 |
agcacagggtaagctcttctcaacacacctttatgtaaaggtttgagttgttgttattgttgaaatctaatgaatttgtgatgggcacttggcaggacta |
48486954 |
T |
 |
| Q |
113 |
tgcatgggcgaagcaggggatggtattccccttcttggaattcatggataggtttgtgtttgtg--tgtgattttggttgttgttctgcctgcaagaata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48486953 |
tgcatgggcgaagcaggggatggtattccccttcttggaattcatggataggtttgtgtttgtgtgtgtgattttggttgttgttctgcctgcaagaata |
48486854 |
T |
 |
| Q |
211 |
tttggcttgtattcgctcatattaagaataatcttgttcagattccaggggcagacccgattg |
273 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486853 |
tttggcttgtactcgctcatattaagaataatcttgttcagattccaggggcagacccgattg |
48486791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University