View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14238_low_19 (Length: 232)
Name: NF14238_low_19
Description: NF14238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14238_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 70 - 209
Target Start/End: Complemental strand, 45691790 - 45691650
Alignment:
| Q |
70 |
gtgagcttagattttatataccgattatatgcatgcatcttcaggaaacctnnnnnnnnnnnnnntacacatttgaaggaaaatcagtgtcaagt-at-t |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || | |
|
|
| T |
45691790 |
gtgagcttagattttatataccgattatatgcatgcatcttcaggaaacct-aaaaacaaaaaaatacacatttgaaggaaaatcagtgtcaagtgatat |
45691692 |
T |
|
| Q |
168 |
tgatcctataactaggaaaatacatcaactggcactattact |
209 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
45691691 |
agttgaattaactaggaaaatacatcaactggcactattact |
45691650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University