View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14239_high_15 (Length: 288)
Name: NF14239_high_15
Description: NF14239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14239_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 8 - 272
Target Start/End: Complemental strand, 53582474 - 53582210
Alignment:
| Q |
8 |
tttttacaggtttgcatcaatggcggagctaggagtaannnnnnnaggggcaatttctttagtgtgtgtgtctctattataagaagtaaaaggtacatgt |
107 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53582474 |
tttttacaggtatgtatcaatggcggagctaggagtaatttttttaggggcaatttctttagtgtgtgtgtctctattataagaagtaaaaggtacatgt |
53582375 |
T |
 |
| Q |
108 |
tgtataggtattgaccaatcctgttaaggtcctactgaaacaacaattggttggctttgattcccaacatatgctagacctaattgatcccctgaacttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53582374 |
tgtataggtattgaccaatcctgttaaggtcctactgaaacaacaattggttggctttgattaccaacatatgctagacctaattgatcccctgaacttc |
53582275 |
T |
 |
| Q |
208 |
ttgtggggtgtaggtgacatagttgttatgttacaagaattggctcgtctagggaaccatatatt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53582274 |
ttgtggggtgtaggtgacatagttgttatgttacaagaattggctcgtctagggaaccatatatt |
53582210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University