View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14239_high_22 (Length: 237)
Name: NF14239_high_22
Description: NF14239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14239_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 92 - 212
Target Start/End: Original strand, 18637460 - 18637580
Alignment:
| Q |
92 |
aaaatatggtcaagtcaaggtttctatggactgttgccacctgaatttggttacttcaaaggacgggtatccaagaagatttgatccataattgatgtct |
191 |
Q |
| |
|
||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18637460 |
aaaatatggtcaagtcaaggtttatatcgactattgccacctgaatttggttacttcaaaggacgggtatccaagaagatttgatccacaattgatgtct |
18637559 |
T |
|
| Q |
192 |
caaatcaaagctgaagtagat |
212 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18637560 |
caaatcaaagctgaagtagat |
18637580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University