View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14239_low_10 (Length: 329)
Name: NF14239_low_10
Description: NF14239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14239_low_10 |
 |  |
|
| [»] scaffold0460 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 58 - 314
Target Start/End: Complemental strand, 7055696 - 7055434
Alignment:
| Q |
58 |
tgggttaatagatagtagtggacgaatatgcgagcatgggcaaattctctctct--------atttgaactaaatgcttgtcaattaaggctgcttttca |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7055696 |
tgggttaatagatagtagtggacgaatatgcgagcatgggcaaattctctctctctctctctatttgaactaaatgcttg-caattaaggctgcttttca |
7055598 |
T |
 |
| Q |
150 |
tatcctacatgagcgcgagttcaactcttcttaccgatttgataaatttttggtggataatataatcttttaacacctgaaccttaagtaaaacaagaca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
7055597 |
tatcctacatgagcgcgagttcaactcttcttaccgatttgataactttttggtggataatataatcttttaacatttgaaccttaactaaaataagaca |
7055498 |
T |
 |
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaa |
314 |
Q |
| |
|
|| ||||| ||||||||||| ||||||||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
7055497 |
at-tccgtgaacttaactcagttggtaaagatattgtatatcatatgtaggggttgaggttcaaa |
7055434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 254 - 316
Target Start/End: Original strand, 7388456 - 7388518
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7388456 |
ccgtgaacttaactcagttggtagggatattgcatattatatgcaggggttggggttcaaact |
7388518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 315
Target Start/End: Original strand, 38402259 - 38402313
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
||||||||| |||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
38402259 |
cttaactcagttggtagggatattgcatattatttgcaggggttggggttcaaac |
38402313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Original strand, 5683762 - 5683812
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
5683762 |
cttagctcaattggtaggaatattgcatattatatgcaggggttggggttc |
5683812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Original strand, 16449133 - 16449183
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| |||| |||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
16449133 |
cttagctcagttggtagggatattgcatattatatgcaggggttggggttc |
16449183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Original strand, 34472305 - 34472355
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| |||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
34472305 |
cttaactcagttggtagggatattgcatattatatgcaggagttggggttc |
34472355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 311
Target Start/End: Original strand, 42035332 - 42035394
Alignment:
| Q |
249 |
aatctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| |||||| |||||||| ||| ||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
42035332 |
aatccccgtaagtttaactcagttgataaagatattgtatattatatgcaggggctggggttc |
42035394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 303
Target Start/End: Original strand, 10083160 - 10083213
Alignment:
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggt |
303 |
Q |
| |
|
|||||||| | ||||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
10083160 |
atctccgtgagcttaactcagttggtagggatattgcatattatatgcaggggt |
10083213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 311
Target Start/End: Original strand, 10573114 - 10573159
Alignment:
| Q |
266 |
ctcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
10573114 |
ctcagttggtagggatattgcatattatatgcaggggttggggttc |
10573159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 311
Target Start/End: Complemental strand, 39709243 - 39709202
Alignment:
| Q |
270 |
attggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
39709243 |
attggtagagatattgcatatcatatgcagcagttggggttc |
39709202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 310
Target Start/End: Complemental strand, 8971581 - 8971525
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggtt |
310 |
Q |
| |
|
|||| |||||| |||| ||||||| |||||| ||||| |||||||||||| |||||| |
|
|
| T |
8971581 |
ccgttaacttacctcatttggtaaggatattacatattatatgcaggggtcggggtt |
8971525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 311
Target Start/End: Complemental strand, 24296912 - 24296880
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
24296912 |
gatattgcatattatatgcaggggttggggttc |
24296880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 15)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 250 - 315
Target Start/End: Original strand, 10241722 - 10241787
Alignment:
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
|||||||| | ||||||||| |||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10241722 |
atctccgtgagcttaactcagttggtagggatattgcatattatatgcaggggttggggttcaaac |
10241787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 311
Target Start/End: Original strand, 2362977 - 2363027
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
2362977 |
cttaactcagttggtagggatattgcatattatatgcaggggttggggttc |
2363027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 311
Target Start/End: Complemental strand, 19891488 - 19891438
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| ||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
19891488 |
cttaactcagttggtaaggatattgcattttatatgcaggggttggggttc |
19891438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 266 - 315
Target Start/End: Complemental strand, 10758861 - 10758812
Alignment:
| Q |
266 |
ctcaattggtaaagatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||| |||| |
|
|
| T |
10758861 |
ctcaattggtaaagatattgcatattatatgtaggggctggggtttaaac |
10758812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 261 - 316
Target Start/End: Original strand, 6558809 - 6558864
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||| ||||||||||| |||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
6558809 |
cttagctcaattggtagggatattgcatattatatgcaggggtcggggttcgaact |
6558864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 248 - 311
Target Start/End: Original strand, 35241391 - 35241454
Alignment:
| Q |
248 |
caatctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||||| | |||| ||| |||||| ||||||||||||| |||||||||||| ||||||| |
|
|
| T |
35241391 |
caatctccgtgagcttagttcagttggtagagatattgcatattatatgcaggggtcggggttc |
35241454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Original strand, 546810 - 546860
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
546810 |
cttaactcagttggtagggatattgcatattatatgcaggggtcggggttc |
546860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Complemental strand, 33736076 - 33736026
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
33736076 |
cttaactcagttggtagggatattgcatattatatgcaggggtcggggttc |
33736026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 316
Target Start/End: Complemental strand, 35099322 - 35099260
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||| ||| |||||||||||| | ||||| |||| |
|
|
| T |
35099322 |
ccgtgaacttaactcaattgatacagatattgcgtattatatgcaggggtcgaggttcgaact |
35099260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Complemental strand, 1269229 - 1269188
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcagggg |
302 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
1269229 |
cttagctcaattggtagagatattgcatattatatgcagggg |
1269188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Complemental strand, 17064920 - 17064879
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcagggg |
302 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
17064920 |
cttaactcaattggtagggatattgcatattatatgcagggg |
17064879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 316
Target Start/End: Complemental strand, 35113006 - 35112969
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
35113006 |
gatattgcatattatatgcaggggttggggttcgaact |
35112969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 311
Target Start/End: Original strand, 16280252 - 16280304
Alignment:
| Q |
259 |
aacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| | |||||| ||||||||||| | ||||| |||||||||||||| |
|
|
| T |
16280252 |
aacttaactgagttggtagagatattgcattttatatgtaggggttggggttc |
16280304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 311
Target Start/End: Complemental strand, 26065481 - 26065449
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
26065481 |
gatattgcatattatatgcaggggttggggttc |
26065449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 247 - 311
Target Start/End: Original strand, 26912827 - 26912891
Alignment:
| Q |
247 |
acaatctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||| |||| | |||||||||||||||| |||||||||||| ||||| ||||| ||||||| |
|
|
| T |
26912827 |
acaatccccgtgagcttaactcaattggtagggatattgcatattatatgtaggggccggggttc |
26912891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 12)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 311
Target Start/End: Complemental strand, 40200178 - 40200121
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||| ||||||||| |||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
40200178 |
ccgtaagcttaactcagttggtagaaatattgcatattatatgcaggggttggggttc |
40200121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 262 - 313
Target Start/End: Complemental strand, 4232403 - 4232352
Alignment:
| Q |
262 |
ttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaa |
313 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
4232403 |
ttaactcaattggtagagatattgcatattatatgcagaggtaggggttcaa |
4232352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 254 - 316
Target Start/End: Complemental strand, 27704368 - 27704306
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||| ||||||||||| |||||| ||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
27704368 |
ccgtgaacttaactcagttggtaggaatattgcatattatatgcaggggttggggttcgaact |
27704306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 250 - 311
Target Start/End: Complemental strand, 9712271 - 9712210
Alignment:
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||| | ||||||||| |||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
9712271 |
atctccgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttc |
9712210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 48674623 - 48674570
Alignment:
| Q |
262 |
ttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
|||||||| ||| ||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
48674623 |
ttaactcagttgataaggatattgcattttatatgcaggggttggggttcaaac |
48674570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 315
Target Start/End: Original strand, 11654174 - 11654230
Alignment:
| Q |
259 |
aacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| ||||||||| |||| | ||||||| |
|
|
| T |
11654174 |
aacttaactcaattggtagagatatttcatattatatgcaggagttgagattcaaac |
11654230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 315
Target Start/End: Original strand, 23817196 - 23817250
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
|||||||||||||||| |||||||||| | ||||| |||||| ||||||||||| |
|
|
| T |
23817196 |
cttaactcaattggtagggatattgcatgttatatgtaggggtcggggttcaaac |
23817250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Original strand, 47463939 - 47463989
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| |||||| | ||||||||| | |||||||||||||||||||| |
|
|
| T |
47463939 |
cttaactcagttggtagaaatattgcatgttatatgcaggggttggggttc |
47463989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 21762961 - 21762912
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggt |
303 |
Q |
| |
|
|||| |||||| |||| ||||||| |||||||||||| |||||||||||| |
|
|
| T |
21762961 |
ccgtgaacttatctcagttggtaaggatattgcatattatatgcaggggt |
21762912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 310
Target Start/End: Original strand, 28805308 - 28805357
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggtt |
310 |
Q |
| |
|
|||| |||| |||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
28805308 |
cttagctcagttggtagggatattgcatatcatatgcaggggtcggggtt |
28805357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 310
Target Start/End: Complemental strand, 37240134 - 37240085
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggtt |
310 |
Q |
| |
|
||||||||| |||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
37240134 |
cttaactcagttggtaaagacattgcataatatatacaggggttggggtt |
37240085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 316
Target Start/End: Original strand, 12428217 - 12428253
Alignment:
| Q |
280 |
atattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
12428217 |
atattgcatattatatgcaggggttggggttcgaact |
12428253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 250 - 303
Target Start/End: Original strand, 17601076 - 17601129
Alignment:
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggt |
303 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
17601076 |
atctccgtgaacttaactcagttggtagggatattgcatatcatatgcaggggt |
17601129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 311
Target Start/End: Complemental strand, 35798088 - 35798038
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| ||| || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
35798088 |
cttaactcagttgttagagatattgcatattatatgcaggggttggggttc |
35798038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 254 - 310
Target Start/End: Complemental strand, 36089194 - 36089138
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggtt |
310 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||| |||| |||||||||||||| |
|
|
| T |
36089194 |
ccgtaaacttaactcagttggcagggatattgcatattatatacaggggttggggtt |
36089138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Complemental strand, 7379662 - 7379612
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| ||||||| |||||||||||| |||||||| ||| ||||||| |
|
|
| T |
7379662 |
cttaactcagttggtaaggatattgcatattatatgcagaggtcggggttc |
7379612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 266 - 316
Target Start/End: Complemental strand, 11946098 - 11946048
Alignment:
| Q |
266 |
ctcaattggtaaagatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
11946098 |
ctcaattggtaacgatattacatattatatgcaggggttaaggttcaaact |
11946048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Original strand, 15764938 - 15764988
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| |||| |||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
15764938 |
cttagctcagttggtagggatattgcatattatatgcaggggttggggttc |
15764988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 311
Target Start/End: Original strand, 17487700 - 17487762
Alignment:
| Q |
249 |
aatctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| |||||| |||| |||||| |||||||||||| |||||||| || |||||||| |
|
|
| T |
17487700 |
aatctccgtgaacttagctcagttggtagggatattgcatattatatgcagtggctggggttc |
17487762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 311
Target Start/End: Complemental strand, 40363148 - 40363083
Alignment:
| Q |
246 |
gacaatctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||| ||||| | ||||||||| |||||| |||||||||||| ||||| |||||| ||||||| |
|
|
| T |
40363148 |
gacaatatccgtgagcttaactcagttggtagggatattgcatattatatgtaggggtcggggttc |
40363083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 311
Target Start/End: Complemental strand, 2950406 - 2950374
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
2950406 |
gatattgcatattatatgcaggggttggggttc |
2950374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 12)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 250 - 310
Target Start/End: Original strand, 8282339 - 8282399
Alignment:
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggtt |
310 |
Q |
| |
|
|||||||| | ||||||||||||| ||| |||||||||||| |||||||||||||| |||| |
|
|
| T |
8282339 |
atctccgtgagcttaactcaattgataaggatattgcatattatatgcaggggttgaggtt |
8282399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 262 - 316
Target Start/End: Complemental strand, 9477497 - 9477443
Alignment:
| Q |
262 |
ttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| | | |||||||||| |
|
|
| T |
9477497 |
ttaactcaattggttaagatattgcatattatatgcagggatcgtggttcaaact |
9477443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 250 - 311
Target Start/End: Complemental strand, 13578538 - 13578477
Alignment:
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||| | ||||||||| |||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
13578538 |
atctccgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttc |
13578477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 37310036 - 37310089
Alignment:
| Q |
262 |
ttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
37310036 |
ttaactcagttggtatggatattgcatattatatgtaggggttggggttcaaac |
37310089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 300
Target Start/End: Complemental strand, 5179956 - 5179905
Alignment:
| Q |
249 |
aatctccgtaaacttaactcaattggtaaagatattgcatatcatatgcagg |
300 |
Q |
| |
|
|||| |||| ||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
5179956 |
aatccccgtgaacttaactcagttggtaaggatattgcatattatatgcagg |
5179905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 248 - 303
Target Start/End: Original strand, 10402436 - 10402491
Alignment:
| Q |
248 |
caatctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggt |
303 |
Q |
| |
|
||||| |||| | ||||||||| |||||| ||||||||||||| |||||||||||| |
|
|
| T |
10402436 |
caatccccgtgagcttaactcagttggtagagatattgcatattatatgcaggggt |
10402491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 311
Target Start/End: Original strand, 47890706 - 47890753
Alignment:
| Q |
264 |
aactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||| |||||| ||||||||||||| |||||||||||| ||||||| |
|
|
| T |
47890706 |
aactcagttggtagagatattgcatattatatgcaggggtcggggttc |
47890753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 316
Target Start/End: Complemental strand, 3157286 - 3157224
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||| |||||| |||| |||||| ||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
3157286 |
ccgtgaacttagctcagttggtaggaatattgcatattatatgcaggggtcggggttcaaact |
3157224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 315
Target Start/End: Original strand, 30057235 - 30057284
Alignment:
| Q |
266 |
ctcaattggtaaagatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30057235 |
ctcagttggtagggatattgcatattatatgcaggggtcggggttcaaac |
30057284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 311
Target Start/End: Complemental strand, 481597 - 481557
Alignment:
| Q |
271 |
ttggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
481597 |
ttggtagagatattgcatattatatgtaggggttggggttc |
481557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 316
Target Start/End: Complemental strand, 52757321 - 52757285
Alignment:
| Q |
280 |
atattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
52757321 |
atattgcatattatatgcaggggttggggttcgaact |
52757285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 303
Target Start/End: Complemental strand, 56479290 - 56479246
Alignment:
| Q |
259 |
aacttaactcaattggtaaagatattgcatatcatatgcaggggt |
303 |
Q |
| |
|
||||||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
56479290 |
aacttaactcagttggtagggatattgcatattatatgcaggggt |
56479246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 25638458 - 25638409
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggt |
303 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
25638458 |
ccgtgaacttaactcaattggtagagatattgcatattatatgtaggggt |
25638409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 254 - 311
Target Start/End: Original strand, 29098693 - 29098750
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||| |||| |||||||||||| ||||||| |
|
|
| T |
29098693 |
ccgtgaacttaactcagttggtagagatattgtatattatatgcaggggtcggggttc |
29098750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 311
Target Start/End: Complemental strand, 4200649 - 4200597
Alignment:
| Q |
259 |
aacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||||| |||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
4200649 |
aacttaactcagttggtagggatattgcatattatatgcaggggtcggggttc |
4200597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 279 - 311
Target Start/End: Complemental strand, 29062545 - 29062513
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29062545 |
gatattgcatatcatatgcaggggttggggttc |
29062513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 300
Target Start/End: Original strand, 25833820 - 25833870
Alignment:
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcagg |
300 |
Q |
| |
|
|||||||| | |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
25833820 |
atctccgttagcttagctcagttggtaaagatattgcatattatatgcagg |
25833870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Complemental strand, 29373511 - 29373461
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
||||||||| ||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
29373511 |
cttaactcagttggtaaggatattgcatattatatgcaggggccggggttc |
29373461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 311
Target Start/End: Original strand, 15491866 - 15491911
Alignment:
| Q |
266 |
ctcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| |||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
15491866 |
ctcagttggtagaaatattgcatattatatgcaggggttggggttc |
15491911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 278 - 315
Target Start/End: Original strand, 23954869 - 23954906
Alignment:
| Q |
278 |
agatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
23954869 |
agatattgcatattatatgcaggggttgaggttcaaac |
23954906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 310
Target Start/End: Complemental strand, 2007152 - 2007096
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggtt |
310 |
Q |
| |
|
|||| ||||||||||| |||||| | ||||||||||| ||||||||| || |||||| |
|
|
| T |
2007152 |
ccgtgaacttaactcagttggtagaaatattgcatattatatgcaggagtcggggtt |
2007096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 301
Target Start/End: Complemental strand, 46176864 - 46176824
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggg |
301 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
46176864 |
cttaactcaattggtatggatattgcatattatatgcaggg |
46176824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 10)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 250 - 311
Target Start/End: Original strand, 19011352 - 19011413
Alignment:
| Q |
250 |
atctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||| | |||| ||||||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
19011352 |
atctccgtgagcttagctcaattggtagggatattgcatattatatgcaggggctggggttc |
19011413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 311
Target Start/End: Original strand, 2556557 - 2556614
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||| |||| |||| |||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
2556557 |
ccgtaagcttagctcagttggtagggatattgcatattatatgcaggggctggggttc |
2556614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 278 - 315
Target Start/End: Original strand, 11065145 - 11065182
Alignment:
| Q |
278 |
agatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11065145 |
agatattgcatattatatgcaggggtcggggttcaaac |
11065182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Complemental strand, 27178770 - 27178729
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcagggg |
302 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
27178770 |
cttaactcaattggtaaggatattgtatattatatgcagggg |
27178729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 311
Target Start/End: Complemental strand, 28564414 - 28564357
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||| ||||||||| || ||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
28564414 |
ccgtaagcttaactcagttagtagggatattgcagattatatgcaggggttggggttc |
28564357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 299
Target Start/End: Original strand, 35283502 - 35283547
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcag |
299 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
35283502 |
ccgtgaacttaactcagttggtaaagatattacatattatatgcag |
35283547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 311
Target Start/End: Original strand, 40634210 - 40634259
Alignment:
| Q |
262 |
ttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
40634210 |
ttaactcagttggtagggatattgcatattatatgcaggggatggggttc |
40634259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 315
Target Start/End: Original strand, 8415755 - 8415791
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8415755 |
gatattgcatattatatgcaggggtcggggttcaaac |
8415791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 315
Target Start/End: Complemental strand, 32556973 - 32556937
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttcaaac |
315 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
32556973 |
gatattgcatattatatgcagaggttggggttcaaac |
32556937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 311
Target Start/End: Complemental strand, 39922161 - 39922109
Alignment:
| Q |
259 |
aacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||| |||||||| || ||||||| ||||| ||||||||||||| |||||| |
|
|
| T |
39922161 |
aacttatctcaattgttagagatattacatattatatgcaggggttagggttc |
39922109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 311
Target Start/End: Complemental strand, 13265 - 13215
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| |||| |||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
13265 |
cttagctcagttggtagggatattgcatattatatgcaggggttggggttc |
13215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 307
Target Start/End: Complemental strand, 27094869 - 27094823
Alignment:
| Q |
261 |
cttaactcaattggtaaagatattgcatatcatatgcaggggttggg |
307 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
27094869 |
cttaactcagttggtagggatattgcatattatatgcaggggttggg |
27094823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 316
Target Start/End: Original strand, 5944452 - 5944489
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttcaaact |
316 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
5944452 |
gatattgcatattatatgcaggggtcggggttcaaact |
5944489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 311
Target Start/End: Original strand, 6210055 - 6210112
Alignment:
| Q |
254 |
ccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||| |||||| |||| |||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
6210055 |
ccgtgaacttagctcagttggtagggatattgcatattatatgcaggggctggggttc |
6210112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 303
Target Start/End: Original strand, 315642 - 315699
Alignment:
| Q |
246 |
gacaatctccgtaaacttaactcaattggtaaagatattgcatatcatatgcaggggt |
303 |
Q |
| |
|
||||||| |||| |||||| |||| ||||||| |||||||||| | |||||||||||| |
|
|
| T |
315642 |
gacaatccccgtgaacttagctcagttggtaaggatattgcattttatatgcaggggt |
315699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 311
Target Start/End: Original strand, 39672 - 39704
Alignment:
| Q |
279 |
gatattgcatatcatatgcaggggttggggttc |
311 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
39672 |
gatattgcatattatatgcaggggttggggttc |
39704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University