View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14239_low_18 (Length: 248)
Name: NF14239_low_18
Description: NF14239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14239_low_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 248
Target Start/End: Complemental strand, 4195899 - 4195660
Alignment:
| Q |
9 |
cagaaagattattcttgtgaagatcaagaatcccaagctgatgaagattcacaatactctcgggcaatgaagaattgaaccggttattaccacccgaaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4195899 |
cagaaagattattcttgtgaagatcaagaatcccaagctgatgaagattcacaatactctcgggcaatgaagaattaaaccggttattaccacccgaaaa |
4195800 |
T |
 |
| Q |
109 |
ttactgaagattttccaacaatccaatctcttcaggaatcacaccagagaaattattattcgtcaaagtcaactgagacaaattcccagctccaccaata |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195799 |
ttcctgaagattttccaacaatccaatctcttcaggaatcacaccagagaaattattattcgtcaaagtcaactgagacaaattcccagctccaccaata |
4195700 |
T |
 |
| Q |
209 |
gtcttaccaattgaaccagaaaacaagttatcaacaagct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195699 |
gtcttaccaattgaaccagaaaacaagttatcaacaagct |
4195660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University