View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14239_low_19 (Length: 246)
Name: NF14239_low_19
Description: NF14239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14239_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 13282640 - 13282430
Alignment:
| Q |
18 |
ttctctatcttgtcaattattttgtttggcaatgtggtgggtgaggatctaagtgcttgttaccatttgtacattgtaccatactgttaaagggtaacta |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
13282640 |
ttctctatcttgtcaattatcttgtttggcaatgtagtgggtgaggatctaagtgcttgttaccatttgtacattgtaccatactgtaaaagtgtaacta |
13282541 |
T |
 |
| Q |
118 |
ttgttagaagtttatgtaactatacttcttttgtgagcctcttaaaatgtttatcttctaggtactagcaataggagtagtaattttcaatgtaaatatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13282540 |
ttgttagaagtttatgtaactatacttcttttgtgagcctcttaaaatgtttatcttctaggtactagcaataggagtagtaattttcaatgtaaatatt |
13282441 |
T |
 |
| Q |
218 |
ttagcaactac |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
13282440 |
ttagcaactac |
13282430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University