View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14239_low_21 (Length: 241)
Name: NF14239_low_21
Description: NF14239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14239_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 75 - 222
Target Start/End: Complemental strand, 5301703 - 5301556
Alignment:
| Q |
75 |
gttaaggatgagggtcgagccatgacagattgatgtgggtaccggcggctggaattgatctgaatgaagcttcaagcgtagttctgggacttctcctatg |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
5301703 |
gttaaggatgagggtcgagccatgacagattgatatgggtagcggcggctggaattgatctgaatgaagcttcaagcgtagttctcgagcttctcctatg |
5301604 |
T |
 |
| Q |
175 |
ccctgaggaacttggtcggaattagtgcgtgctggaaaatttacttat |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5301603 |
ccctgaggaacttggtcggaattagtgtgtgctggaaaatttacttat |
5301556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 73
Target Start/End: Complemental strand, 5301856 - 5301791
Alignment:
| Q |
8 |
aaagaaagtgtccaagacattcctcaaagccttaacaattaacacaaaacaaactattaaacaagt |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
5301856 |
aaagaaagtgtccaagacattcctcaaagccttaacaattaacataaaacaaactaataaacaagt |
5301791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University