View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14240_high_7 (Length: 284)
Name: NF14240_high_7
Description: NF14240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14240_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 49163491 - 49163693
Alignment:
| Q |
1 |
atcataaccgacgtatgccaattcccattgccaaggaagactcaagcatacaattcatcacaaatcctaatgatttattctacctgaaaccccagtgtcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
49163491 |
atcataaccgacgtatgccaattcccattgccaaggaagactcaagcatacaattcatcacaaatcctaatgatttattctacctaaaatcccagtgtcc |
49163590 |
T |
 |
| Q |
101 |
atgaccagcaacccaaagaatatggacagtctcactgctcctgctattcgtttctttaagattgttacctcaacaaatattcaagatggaacccttgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49163591 |
atgaccagcaacccaaagaatatgtacagtctcactgctcctgctattcgtttctttaagattgttacctcaacaaatattcaagatggaacccttgtaa |
49163690 |
T |
 |
| Q |
201 |
gca |
203 |
Q |
| |
|
||| |
|
|
| T |
49163691 |
gca |
49163693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 235 - 282
Target Start/End: Original strand, 49163717 - 49163766
Alignment:
| Q |
235 |
catatttcaacttttgaacgaccgaa--atttaagtaaagtttggtagtt |
282 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||| ||||| |
|
|
| T |
49163717 |
catatttcaacttttgaacgaccgaaatatttaagtaatgtttgatagtt |
49163766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 43749943 - 43749994
Alignment:
| Q |
149 |
cgtttctttaagattgttacctcaacaaatattcaagatggaacccttgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43749943 |
cgtttctttaagattgttacctcaacaaatattcaagatggaacccttgtaa |
43749994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University