View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_high_12 (Length: 278)
Name: NF14242_high_12
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 68 - 192
Target Start/End: Complemental strand, 38940965 - 38940841
Alignment:
| Q |
68 |
tttttggaggtttgttacatcaaagtcacgattagaaatatatggtgcatttggaatataatgatgttgactttcgcttggaggtggctaatgtggcaaa |
167 |
Q |
| |
|
|||||||||||||||| | |||||||||| |||| |||||||||||||||||||||||| || ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
38940965 |
tttttggaggtttgttgcgtcaaagtcaccattaaaaatatatggtgcatttggaatattataatgttaactttcacttggaggtggctaatgtggcaaa |
38940866 |
T |
|
| Q |
168 |
attggtcgatcaaattaaaagtatt |
192 |
Q |
| |
|
|||||| ||||||| |||| ||||| |
|
|
| T |
38940865 |
attggtagatcaaactaaaggtatt |
38940841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 193
Target Start/End: Original strand, 5434464 - 5434506
Alignment:
| Q |
151 |
gtggctaatgtggcaaaattggtcgatcaaattaaaagtattg |
193 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
5434464 |
gtggataatgtggcaaaattggtggatcaaattaaaaatattg |
5434506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University