View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_high_21 (Length: 233)
Name: NF14242_high_21
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 30 - 207
Target Start/End: Original strand, 50228370 - 50228550
Alignment:
| Q |
30 |
aagggaaatcaccatacttttatttataaggaaaatgaaataaaatatcaaacatgtaattttagaaaacnnnnnnnnnn---cagtacaattgttcaga |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
50228370 |
aagggaaatcaccatacttttatttataaggaaaatgaaataaaatatcaaacatgtaattttagaaaactttttttttttttcagtacaattgttccga |
50228469 |
T |
 |
| Q |
127 |
atgttttttgtggtgtaaattttgaaccctttctaaggaaggtgacaactgccaaatgagaggaaattttagctttggaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50228470 |
atgttttttgtggtgtaaattttgaaccctttctaaggaaggtgacaactgccaaacgagaggaaattttagctttggaat |
50228550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University