View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_high_22 (Length: 220)
Name: NF14242_high_22
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 15643552 - 15643736
Alignment:
| Q |
20 |
ttaaaagttaaaagagtttaaggaatccgatttaaacttgcacaaaggnnnnnnn--gtaatacatagcttattactcatgattgttgaggtggttagac |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15643552 |
ttaaaagttaaaagagtttaagaaatccgatttaaacttggacaaaggaaaaaaaaggtaatacatagcttattactcatgattgttgaggtggttagac |
15643651 |
T |
 |
| Q |
118 |
attaaatatagatacatttcctaacaaaatttaaaattttgatttgctttgttgcaggagtctagccaggtgttatcatgggttca |
203 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
15643652 |
attaaatatagatacatctcctaacaaaatttaaaattttgatttgcttcgttgca-gagtctagccaggtgttataatgggttca |
15643736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University