View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_low_11 (Length: 415)
Name: NF14242_low_11
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 2e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 204 - 404
Target Start/End: Original strand, 32778115 - 32778314
Alignment:
| Q |
204 |
tagaaacacaagagagcttaagtttcaagcttgtctctatgaagaagtgactctatacctagtggagatggtctcaataaacggtagaaaccaaatagga |
303 |
Q |
| |
|
|||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32778115 |
tagaaaca-aagaggggttaagtttcaagcttgtctctatgaagaagtgactctatacctagtggagatggtctcaataaacggtagaaaccgaatagga |
32778213 |
T |
 |
| Q |
304 |
gtcttctttagacataaagtttgcacttgtattttgctcacctaaaatatacaccaaaataaaatttcttattgttttaaggtcttaccaatttcgagaa |
403 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
32778214 |
gtcttctttagacataaaatttgcacttgtattttgctcacctaaaatatacaccaaaataaaatttcttattgttttaaggtcttatcgatttcgagaa |
32778313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University