View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_low_16 (Length: 311)
Name: NF14242_low_16
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 10 - 297
Target Start/End: Original strand, 44573602 - 44573889
Alignment:
| Q |
10 |
caagaagaaagattccaaattaggtctgttttttatgcatcaaagtgtgtatatgatgcaacctttgataaaatttcaattgctgcaattttaaaacaag |
109 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44573602 |
caagaagaaagattcgaaattaggtctgttttttatgcatcaaagtgtgtatatgatgcaacctttgataaaatttcaattgctgcaattttaaaacaag |
44573701 |
T |
 |
| Q |
110 |
attgagatatcttggagaattgtcatagtcgtacagtgataagttgaagaaagtaaggctacaaggtttgaggaaacaatatgaattgcttcagatgaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
44573702 |
attgagatatcttggagaattgtcatagtcgtacagtgataaggtgaagaaagtaaggctacaaggtttgaggaaataatatgaattgcttcagataaag |
44573801 |
T |
 |
| Q |
210 |
gggtgatttctttgtaaaggtgcgaggtaccataaactccatggctcagaatggagagaacctcatagatcagcaagcatgtgaaaaa |
297 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44573802 |
gggtgatttctttgtaaagttgcgaggtaccataaactccatggctcataatggagagaacctcatagatcagcaagcatgtgaaaaa |
44573889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University