View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_low_20 (Length: 271)
Name: NF14242_low_20
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 34563703 - 34563466
Alignment:
| Q |
20 |
gactttcaatcctatgacattaaatattaaattaatcaaaatcttaataaacaatttttactatccaatctccttcaaatannnnnnnnnactatccaat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||| |
|
|
| T |
34563703 |
gactttcaatcctatgacattaaatattaaattaatcaaaatcttaataaacaatttttactatccaatctacttcaattttttttttttactatccaat |
34563604 |
T |
|
| Q |
120 |
caaatttagtcaaccattttctttgatatcaaaagattgaagcaatttgttagttttatatatgtcaannnnnnnggattatatgatcggcatagattgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34563603 |
caaatttagtcaaccattttctttgatatcaaaagattggagcaatttgctagttttatatatgtcaaattttttggattatatgatcggcatagattgg |
34563504 |
T |
|
| Q |
220 |
gttagaggttttattttctatgactttacatccattct |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563503 |
gttagaggttttattttctatgactttacatccattct |
34563466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University