View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_low_22 (Length: 263)
Name: NF14242_low_22
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 2258541 - 2258778
Alignment:
| Q |
17 |
atgaaataggatcatattcatatagtatgaaaagatgtggtggaaaagaaagataagg-tggtttgtgattatgattgtgaaccatggaataaagatttt |
115 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2258541 |
atgaaatgggatcatattcatatagtatgaaaatatgtggtggaaaagaaagataagggtggtttgtgattatgattgtgaaccatggaataaagatttt |
2258640 |
T |
|
| Q |
116 |
ggctagtgacttggcttgaatctgttggtttgttttggattacagatatttttaccctttcactttgttgatatgaatttggacgtatgatatcttgttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2258641 |
ggctagtgacttggcttgaatctgttggtttgttttggattacagatatttttaccctttcactttgttgatatgaatttggacgtatgatatcttgttc |
2258740 |
T |
|
| Q |
216 |
taatgttacatgttaacaaatatgtgactgaacctatg |
253 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
2258741 |
taatgttaaatgttaacaaatatgtgactaaacctatg |
2258778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University