View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_low_25 (Length: 243)
Name: NF14242_low_25
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 24562215 - 24562005
Alignment:
| Q |
18 |
actaatagtgcggctgatgttgcgcattggattgactatggatatgagagatctatgttttattttatttgtattctcttttggctcgataatttatgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562215 |
actaatagtgcggctgatgttgcgcattggattgactatggatatgagagatctatgttttattttatttgtattctcttttggctcgataatttatgat |
24562116 |
T |
|
| Q |
118 |
attatgctttactaacagaacatgactgtctcattag-nnnnnnnnagcttacagttttttgatttctcccatctttatgttttcatcagaaatcattgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562115 |
attatgctttactaacagaacatgactgtctcattagtttttttttagcttacagttttttgatttctcccatctttatgttttcatcagaaatcattgt |
24562016 |
T |
|
| Q |
217 |
atgaagtctgt |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
24562015 |
atgaagtctgt |
24562005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University