View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_low_32 (Length: 218)
Name: NF14242_low_32
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 29 - 154
Target Start/End: Complemental strand, 23679237 - 23679110
Alignment:
| Q |
29 |
ttctttacatatgatacttgtgtcatctaaacatattgctttggtatgataattgcagcatatttcagttgacaatgtatct--ctctattggtttatag |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23679237 |
ttctttacatatgatacttgtgtcatctaaacatattgctttgatatgataattgcagcatatttcagttgacaatgtatctctctctattggtttatag |
23679138 |
T |
 |
| Q |
127 |
aagattttgtgagatctaatacattctg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
23679137 |
aagattttgtgagatctaatacattctg |
23679110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 146 - 200
Target Start/End: Complemental strand, 23672561 - 23672507
Alignment:
| Q |
146 |
tacattctgaggttgtagtcattactcaaattgtttgattggcattctacctttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23672561 |
tacattctgaggttgtagtcattactcaaattgtttgattggcattctacctttg |
23672507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 162
Target Start/End: Complemental strand, 23747139 - 23747087
Alignment:
| Q |
110 |
tctctattggtttatagaagattttgtgagatctaatacattctgaggttgta |
162 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| | |||||| ||| |||||| |
|
|
| T |
23747139 |
tctctattggttcatagaagattctgtgagatccagtacattatgatgttgta |
23747087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University