View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14242_low_33 (Length: 206)
Name: NF14242_low_33
Description: NF14242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14242_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 9 - 180
Target Start/End: Original strand, 28798874 - 28799045
Alignment:
| Q |
9 |
agcagagaaagtaccccgggtgtacataaggacaaaacatgacaaagtagtgaagccagaacaacaagaagtcatgataaagagggggccaccattgaat |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||| |||||||||||||| |
|
|
| T |
28798874 |
agcagagaaagtaccccgcgtgtacataaggacaaaacatgacaaagtggtgaagccagaacaacaagaagccatgatcaagaggtggccaccattgaat |
28798973 |
T |
|
| Q |
109 |
gtgtatgaactagaaaatagtgatcatagtcctttcttctctaatcctttcattctctttgatgtgtttgta |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||| |
|
|
| T |
28798974 |
gtgtatgaactagaaaatagtgatcatagtcctttcttctctactcctttcattctctttggtgtgcttgta |
28799045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University